Mutants (Isolated)

tm2190

Allele Nametm2190
Sequence NameY69A2AR.30
CGC Namemdf-2
Worm BaseAllele Name tm2190
CGC Name mdf-2
Sequence Y69A2AR.30
Phenotypehomozygous viable. Dr. A. Dernburg: No defects in growth, fertility or meiotic chromosome behavior.
Mutation site156408/156409-157272/157273 (864 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(152634..152705, 153629..153770, 155719..155781, 156646..156763, 156828..156974, 157025..157094))
Map position-6.81
Balancer
Map position of balancer
Sequence of primersExtRev:GCCATACCAGCGACCTGTCT,IntFwd:AGCACCATCACACCACCTGA,ExtFwd:CACGTCTGTCGCCTAGATAT,IntRev:CGACCTGTCTGGCCTTCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Watanabe S, Yamamoto TG, Kitagawa R.
Spindle assembly checkpoint gene mdf-1 regulates germ cell proliferation in response to nutrition signals in C. elegans.
EMBO J. 2008 27(7) 1085-96 
[ PubMed ID = 18309291 ] [ RRC reference ]

Essex A, Dammermann A, Lewellyn L, Oegema K, Desai A.
Systematic analysis in Caenorhabditis elegans reveals that the spindle checkpoint is composed of two largely independent branches.
Mol. Biol. Cell 2009 20(4) 1252-67 
[ PubMed ID = 19109417 ] [ RRC reference ]

Tarailo-Graovac M, Wang J, Chu JS, Tu D, Baillie DL, Chen N.
Spindle assembly checkpoint genes reveal distinct as well as overlapping expression that implicates MDF-2/Mad2 in postembryonic seam cell proliferation in Caenorhabditis elegans.
BMC Cell Biol. 2010 11 71 
[ PubMed ID = 20858267 ] [ RRC reference ]

Gerhold AR, Ryan J, Vallée-Trudeau JN, Dorn JF, Labbé JC, Maddox PS.
Investigating the regulation of stem and progenitor cell mitotic progression by in situ imaging.
Curr. Biol. 2015 25(9) 1123-34 
[ PubMed ID = 25819563 ] [ RRC reference ]

Bohr T, Nelson CR, Klee E, Bhalla N.
Spindle assembly checkpoint proteins regulate and monitor meiotic synapsis in C. elegans.
J. Cell Biol. 2015 211(2) 233-42 
[ PubMed ID = 26483555 ] [ RRC reference ]