Mutants (Isolated)

tm2181

Allele Nametm2181
Sequence NameT04A8.15
CGC Namehim-18
Worm BaseAllele Name tm2181
CGC Name him-18
Sequence T04A8.15
Phenotypelethal or sterile. Dr. M. Colaiacovo: PLoS Genetics, 5(11), e1000735 (2009)
Mutation site36603/36604-36997/36998 (394 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(35138..35290, 35339..35616, 35709..36771, 36817..37150, 37198..37290, 37335..37455, 37507..37562, 37637..37695))
Map position-2.8
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:GATCTGACAAGCGGACGAAT,IntFwd:CGGACGAATTGTAGGTGTTC,ExtRev:TCGGTAATCCGTTCATCCTC,IntRev:GTAATCCGTTCATCCTCGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Saito TT, Youds JL, Boulton SJ, Colaiácovo MP.
Caenorhabditis elegans HIM-18/SLX-4 interacts with SLX-1 and XPF-1 and maintains genomic integrity in the germline by processing recombination intermediates.
PLoS Genet. 2009 5(11) e1000735 
[ PubMed ID = 19936019 ] [ RRC reference ]

Schvarzstein M, Pattabiraman D, Libuda DE, Ramadugu A, Tam A, Martinez-Perez E, Roelens B, Zawadzki KA, Yokoo R, Rosu S, Severson AF, Meyer BJ, Nabeshima K, Villeneuve AM.
DNA helicase HIM-6/BLM both promotes MutSγ-dependent crossovers and antagonizes MutSγ-independent interhomolog associations during caenorhabditis elegans meiosis.
Genetics 2014 198(1) 193-207 
[ PubMed ID = 25053665 ] [ RRC reference ]

Saito TT, Mohideen F, Meyer K, Harper JW, Colaiácovo MP.
SLX-1 is required for maintaining genomic integrity and promoting meiotic noncrossovers in the Caenorhabditis elegans germline.
PLoS Genet. 2012 8(8) e1002888 
[ PubMed ID = 22927825 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]