Mutants (Isolated)

tm2179

Allele Nametm2179
Sequence NameY48D7A.2
CGC Nameflp-18
Worm BaseAllele Name tm2179
CGC Name flp-18
Sequence Y48D7A.2
Phenotypehomozygous viable. Dr. K. Ashrai: normal fat content observed by Nile-Red staining. Dr. P. Sengupta: possible bordering phenotype, possible egl. Dr. J. Kaplan: WT aldicarb sensitivity, increased Nile red staining.
Mutation site6696/6697-7982/7983 (1286 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(6181..6271, 6322..6484, 6531..6584, 6633..6782, 6832..6924, 7967..8042))
Map position-12.65
Balancer
Map position of balancer
Sequence of primersIntRev:GGGTTAGACATGCAACGGTG,ExtRev:GAGTGTCATTTGATGGGATG,IntFwd:ACTTCCGTCCGAATCGGAGA,ExtFwd:GACGAACTGTGTTTGACGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Park J, Choi W, Dar AR, Butcher RA, Kim K.
Neuropeptide Signaling Regulates Pheromone-Mediated Gene Expression of a Chemoreceptor Gene in C. elegans.
Mol Cells 2019 42(1) 28-35 
[ PubMed ID = 30453729 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]