| Allele Name | tm2179 |
| Sequence Name | Y48D7A.2 |
| CGC Name | flp-18 |
| Worm Base | Allele Name |
tm2179
|
| CGC Name |
flp-18
|
| Sequence |
Y48D7A.2
|
| Phenotype | homozygous viable. Dr. K. Ashrai: normal fat content observed by Nile-Red staining. Dr. P. Sengupta: possible bordering phenotype, possible egl. Dr. J. Kaplan: WT aldicarb sensitivity, increased Nile red staining. |
| Mutation site | 6696/6697-7982/7983 (1286 bp deletion) |
| Chromosome | X |
| Putative gene structure | complement(join(6181..6271, 6322..6484, 6531..6584, 6633..6782, 6832..6924, 7967..8042)) |
| Map position | -12.65 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:GGGTTAGACATGCAACGGTG,ExtRev:GAGTGTCATTTGATGGGATG,IntFwd:ACTTCCGTCCGAATCGGAGA,ExtFwd:GACGAACTGTGTTTGACGTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Park J, Choi W, Dar AR, Butcher RA, Kim K.
Neuropeptide Signaling Regulates Pheromone-Mediated Gene Expression of a Chemoreceptor Gene in C. elegans.
Mol Cells 2019 42(1) 28-35
[ PubMed ID = 30453729 ]
[ RRC reference ]
|
Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472
[ PubMed ID = 23658528 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.