Mutants (Isolated)

tm2176

Allele Nametm2176
Sequence NameZC395.8
CGC Nameztf-8
Worm BaseAllele Name tm2176
CGC Name ztf-8
Sequence ZC395.8
Phenotypehomozygous viable
Mutation site8218/8219-8742/8743 (524 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(5411..5714, 6179..6343, 7457..7773, 7883..7957, 8002..8145, 8213..8413, 8803..8885, 8933..9240, 9317..9603, 9652..9751, 9802..9881))
Map position-1.85
Balancer
Map position of balancer
Sequence of primersExtFwd:TCATAGCATTTCGACGGCGA,IntRev:CATCTGAATCACAGCCAGAG,ExtRev:ACGTATCTCAGTCACAGAGT,IntFwd:GTACACTGCCATGCTCGCTT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kim HM, Colaiácovo MP.
New Insights into the Post-Translational Regulation of DNA Damage Response and Double-Strand Break Repair in Caenorhabditis elegans.
Genetics 2015 200(2) 495-504 
[ PubMed ID = 25819793 ] [ RRC reference ]

Kim HM, Colaiácovo MP.
ZTF-8 interacts with the 9-1-1 complex and is required for DNA damage response and double-strand break repair in the C. elegans germline.
PLoS Genet. 2014 10(10) e1004723 
[ PubMed ID = 25329393 ] [ RRC reference ]