Mutants (Isolated)

tm2174

Allele Nametm2174
Sequence NameY17D7A.3a
CGC Namenhr-65
Worm BaseAllele Name tm2174
CGC Name nhr-65
Sequence Y17D7A.3a
Phenotypehomozygous viable
Mutation site6750/6751-7206/7207 (456 bp deletion)
ChromosomeV
Putative gene structurejoin(5025..5137, 6132..6244, 6289..6353, 6906..7031, 7311..7520, 8248..8447, 9511..9781, 10888..10995)
Map position18.09
Balancer
Map position of balancer
Sequence of primersIntFwd:AATAGGCCCAATTTAGGCTG,ExtRev:CCCAGGTCACCCCAAATGTC,ExtFwd:CGTATCAGGCCAAATCCGAC,IntRev:TCCCTGCATTTGTCGGGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sonoda S, Ohta A, Maruo A, Ujisawa T, Kuhara A.
Sperm Affects Head Sensory Neuron in Temperature Tolerance of Caenorhabditis elegans.
Cell Rep 2016 16(1) 56-65 
[ PubMed ID = 27320929 ] [ RRC reference ]