Mutants (Isolated)

tm2173

Allele Nametm2173
Sequence NameY40C5A.2
CGC Nameocr-4
Worm BaseAllele Name tm2173
CGC Name ocr-4
Sequence Y40C5A.2
Phenotypehomozygous viable
Mutation site4724/24725-5252/5253 (528 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(3325..3498, 3546..3791, 3866..4145, 4198..4457, 4499..4664, 4910..5145, 5192..5293, 5336..5528, 5697..6178, 6220..6390))
Map position3.33
Balancer
Map position of balancer
Sequence of primersIntFwd:GCCCCCGTAACGCAAATTAA,ExtFwd:TAGAGTGTTGCCCCCGTAAC,IntRev:TAGCGGATCTGGCGATGGAT,ExtRev:AGGTATGTGAGCACCGTAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]