Mutants (Isolated)

tm2171

Allele Nametm2171
Sequence NameW03A3.1
CGC Nameceh-10
Worm BaseAllele Name tm2171
CGC Name ceh-10
Sequence W03A3.1
Phenotypehomozygous viable
Mutation site13291/13292-13627/13628 (336 bp deletion)
ChromosomeIII
Putative gene structurejoin(11462..11566, 11612..11747, 11795..12096, 12464..12647, 13131..13438)
Map position-1.45
Balancer
Map position of balancer
Sequence of primersIntRev:CGATTCGTCTCGTGGTGCAC,IntFwd:TTACGACAGTGACACCACAA,ExtRev:TGTACCATCGAAAAAGCAGC,ExtFwd:GGTGCACCATGATAGGTATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst.) 2008 7(6) 941-50 
[ PubMed ID = 18472307 ] [ RRC reference ]