Mutants (Isolated)

tm2169

Allele Nametm2169
Sequence NameY51H1A.6
CGC Namemcd-1
Worm BaseAllele Name tm2169
CGC Name mcd-1
Sequence Y51H1A.6
Phenotypehomozygous viable
Mutation site31943/31944-33051/33052 (1108 bp deletion)
ChromosomeII
Putative gene structurejoin(31734..31797, 31872..31990, 33683..34614, 35514..35818, 36770..37074)
Map position21.05
Balancer
Map position of balancer
Sequence of primersIntFwd:TCACGGAAAAGCTTCGCCGA,ExtRev:GCTTAGGCTGCTTCGGGCTT,ExtFwd:CTCTACTGCCTCCTCTGCAT,IntRev:CGCCGCGTAGCTTGTATTTG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Luo J, Shah S, Riabowol K, Mains PE.
The Caenorhabditis elegans ing-3 gene regulates ionizing radiation-induced germ-cell apoptosis in a p53-associated pathway.
Genetics 2009 181(2) 473-82 
[ PubMed ID = 19015549 ] [ RRC reference ]