Mutants (Isolated)

tm2157

Allele Nametm2157
Sequence NameC33D12.7
CGC Nameceh-30
Worm BaseAllele Name tm2157
CGC Name ceh-30
Sequence C33D12.7
Phenotypehomozygous viable
Mutation site22105/22106-22823/22824 (718 bp deletion)
ChromosomeX
Putative gene structurejoin(21713..21880, 21949..22150, 22427..22682, 23349..23622)
Map position-11.91
Balancer
Map position of balancer
Sequence of primersIntRev:GGCACAAATTCGTCTATCCA,ExtRev:ACCCCGGCGATAACTACACA,IntFwd:ATATCGGCAAGTGGCCTTAT,ExtFwd:TGTCACTCCGAATATGGGAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Peden E, Kimberly E, Gengyo-Ando K, Mitani S, Xue D.
Control of sex-specific apoptosis in C. elegans by the BarH homeodomain protein CEH-30 and the transcriptional repressor UNC-37/Groucho.
Genes Dev. 2007 21(23) 3195-207 
[ PubMed ID = 18056429 ] [ RRC reference ]