Mutants (Isolated)

tm2146

Allele Nametm2146
Sequence NameY54G2A.35
CGC Nameser-6
Worm BaseAllele Name tm2146
CGC Name ser-6
Sequence Y54G2A.35
Phenotypehomozygous viable. Dr. K. Ashrafi: Cell Metab 7, 533 (2008).
Mutation site209546/209547-210211/210212 (665 bp deletion)
ChromosomeIV
Putative gene structurejoin(209902..210084, 210691..210854, 210912..211218, 212171..212388, 212516..212560, 213591..213879)
Map position-6.84
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGCAGGCATGTAGGTATCT,ExtFwd:GGTAGGCGCCCTAAAGATTC,IntRev:TGACCGAGTTACGGCCTGTT,ExtRev:ATCCGACATCGATGGAGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hoshikawa H, Uno M, Honjoh S, Nishida E.
Octopamine enhances oxidative stress resistance through the fasting-responsive transcription factor DAF-16/FOXO in C. elegans.
Genes Cells 2017 22(2) 210-219 
[ PubMed ID = 28105749 ] [ RRC reference ]

Srinivasan S, Sadegh L, Elle IC, Christensen AG, Faergeman NJ, Ashrafi K.
Serotonin regulates C. elegans fat and feeding through independent molecular mechanisms.
Cell Metab. 2008 7(6) 533-44 
[ PubMed ID = 18522834 ] [ RRC reference ]

Bayer EA, Hobert O.
Past experience shapes sexually dimorphic neuronal wiring through monoaminergic signalling.
Nature 2018 561(7721) 117-121 
[ PubMed ID = 30150774 ] [ RRC reference ]

Gomez-Amaro RL, Valentine ER, Carretero M, LeBoeuf SE, Rangaraju S, Broaddus CD, Solis GM, Williamson JR, Petrascheck M.
Measuring Food Intake and Nutrient Absorption in Caenorhabditis elegans.
Genetics 2015 200(2) 443-54 
[ PubMed ID = 25903497 ] [ RRC reference ]

Yoshida M, Oami E, Wang M, Ishiura S, Suo S.
Nonredundant function of two highly homologous octopamine receptors in food-deprivation-mediated signaling in Caenorhabditis elegans.
J. Neurosci. Res. 2014 92(5) 671-8 
[ PubMed ID = 24446241 ] [ RRC reference ]

Noble T, Stieglitz J, Srinivasan S.
An integrated serotonin and octopamine neuronal circuit directs the release of an endocrine signal to control C. elegans body fat.
Cell Metab. 2013 18(5) 672-84 
[ PubMed ID = 24120942 ] [ RRC reference ]

Tao J, Ma YC, Yang ZS, Zou CG, Zhang KQ.
Octopamine connects nutrient cues to lipid metabolism upon nutrient deprivation.
Sci Adv 2016 2(5) e1501372 
[ PubMed ID = 27386520 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J. Neurosci. 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Nagashima T, Oami E, Kutsuna N, Ishiura S, Suo S.
Dopamine regulates body size in Caenorhabditis elegans.
Dev. Biol. 2016 412(1) 128-138 
[ PubMed ID = 26921458 ] [ RRC reference ]

Brown AE, Yemini EI, Grundy LJ, Jucikas T, Schafer WR.
A dictionary of behavioral motifs reveals clusters of genes affecting Caenorhabditis elegans locomotion.
Proc. Natl. Acad. Sci. U.S.A. 2013 110(2) 791-6 
[ PubMed ID = 23267063 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Yemini E, Jucikas T, Grundy LJ, Brown AE, Schafer WR.
A database of Caenorhabditis elegans behavioral phenotypes.
Nat. Methods 2013 10(9) 877-9 
[ PubMed ID = 23852451 ] [ RRC reference ]