Mutants (Isolated)

tm2143

Allele Nametm2143
Sequence NameK11D9.1a
CGC Nameklp-7
Worm BaseAllele Name tm2143
CGC Name klp-7
Sequence K11D9.1a
Phenotypelethal or sterile. Dr. H. Sawa: embryonic lethal, slightly Unc, escapers are not Psa. Dr. B.J. Meyer: unable to outcross. Dr. O. Blacque: could not assess Dyf phenotype due to lethality.
Mutation site10248/10249-11123/11124 (875 bp deletion)
ChromosomeIII
Putative gene structurejoin(7624..7792, 10035..10153, 10294..10510, 10559..11216, 11267..11728, 11779..12090, 12138..12444)
Map position5.4
Balancerunc-119 (ed3) III
Map position of balancer5.59
Sequence of primersExtFwd:CTTGTCGTCGGGATGCATGT,IntFwd:CGCATCCACGGTGCCGTAAT,ExtRev:TCACTGTCCTGGACTTCTCA,IntRev:CTCACCGATGAAGCTGTCTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bondaz A, Cirillo L, Meraldi P, Gotta M.
Cell polarity-dependent centrosome separation in the C. elegans embryo.
J Cell Biol 2019 218(12) 4112-4126 
[ PubMed ID = 31645459 ] [ RRC reference ]

Gigant E, Stefanutti M, Laband K, Gluszek-Kustusz A, Edwards F, Lacroix B, Maton G, Canman JC, Welburn JPI, Dumont J.
Inhibition of ectopic microtubule assembly by the kinesin-13 KLP-7 prevents chromosome segregation and cytokinesis defects in oocytes.
Development 2017 144(9) 1674-1686 
[ PubMed ID = 28289130 ] [ RRC reference ]

Zheng C, Diaz-Cuadros M, Nguyen KCQ, Hall DH, Chalfie M.
Distinct effects of tubulin isotype mutations on neurite growth in Caenorhabditis elegans.
Mol Biol Cell 2017 28(21) 2786-2801 
[ PubMed ID = 28835377 ] [ RRC reference ]

Han X, Adames K, Sykes EM, Srayko M.
The KLP-7 Residue S546 Is a Putative Aurora Kinase Site Required for Microtubule Regulation at the Centrosome in C. elegans.
PLoS One 2015 10(7) e0132593 
[ PubMed ID = 26168236 ] [ RRC reference ]

Connolly AA, Sugioka K, Chuang CH, Lowry JB, Bowerman B.
KLP-7 acts through the Ndc80 complex to limit pole number in C. elegans oocyte meiotic spindle assembly.
J Cell Biol 2015 210(6) 917-32 
[ PubMed ID = 26370499 ] [ RRC reference ]

Fu H, Zhou H, Yu X, Xu J, Zhou J, Meng X, Zhao J, Zhou Y, Chisholm AD, Xu S.
Wounding triggers MIRO-1 dependent mitochondrial fragmentation that accelerates epidermal wound closure through oxidative signaling.
Nat Commun 2020 11(1) 1050 
[ PubMed ID = 32103012 ] [ RRC reference ]

Chuang M, Goncharov A, Wang S, Oegema K, Jin Y, Chisholm AD.
The microtubule minus-end-binding protein patronin/PTRN-1 is required for axon regeneration in C. elegans.
Cell Rep 2014 9(3) 874-83 
[ PubMed ID = 25437544 ] [ RRC reference ]

Kurup N, Yan D, Goncharov A, Jin Y.
Dynamic microtubules drive circuit rewiring in the absence of neurite remodeling.
Curr Biol 2015 25(12) 1594-605 
[ PubMed ID = 26051896 ] [ RRC reference ]

Sugioka K, Mizumoto K, Sawa H.
Wnt regulates spindle asymmetry to generate asymmetric nuclear β-catenin in C. elegans.
Cell 2011 146(6) 942-54 
[ PubMed ID = 21925317 ] [ RRC reference ]

van der Vaart A, Rademakers S, Jansen G.
DLK-1/p38 MAP Kinase Signaling Controls Cilium Length by Regulating RAB-5 Mediated Endocytosis in Caenorhabditis elegans.
PLoS Genet 2015 11(12) e1005733 
[ PubMed ID = 26657059 ] [ RRC reference ]

Yogev S, Cooper R, Fetter R, Horowitz M, Shen K.
Microtubule Organization Determines Axonal Transport Dynamics.
Neuron 2016 92(2) 449-460 
[ PubMed ID = 27764672 ] [ RRC reference ]

Chuang M, Hsiao TI, Tong A, Xu S, Chisholm AD.
DAPK interacts with Patronin and the microtubule cytoskeleton in epidermal development and wound repair.
Elife 2016 5  
[ PubMed ID = 27661253 ] [ RRC reference ]