Mutants (Isolated)

tm2134

Allele Nametm2134
Sequence NameY55B1AL.3
CGC Namehelq-1
Worm BaseAllele Name tm2134
CGC Name helq-1
Sequence Y55B1AL.3
Phenotypehomozygous viable
Mutation site10827/10828-11173/11174 (346 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(3949..4119, 4167..4328, 5429..5695, 5755..5990, 6621..7095, 9995..10169, 10219..10355, 10405..10497, 10596..10964, 11437..11615, 11672..12103, 13124..13199))
Map position-26.7
Balancer
Map position of balancer
Sequence of primersIntRev:TCTCCGTTACATCACCACCT,ExtRev:GATTACGAACGCCTCGAACA,IntFwd:TCAGCACAGCATCCATCCGT,ExtFwd:CCGAATGATGATAGGCCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Taylor MRG, Špírek M, Chaurasiya KR, Ward JD, Carzaniga R, Yu X, Egelman EH, Collinson LM, Rueda D, Krejci L, Boulton SJ.
Rad51 Paralogs Remodel Pre-synaptic Rad51 Filaments to Stimulate Homologous Recombination.
Cell 2015 162(2) 271-286 
[ PubMed ID = 26186187 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst.) 2008 7(6) 941-50 
[ PubMed ID = 18472307 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol. Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]