Mutants (Isolated)

tm2134

Allele Nametm2134
Sequence NameY55B1AL.3
CGC Namehelq-1
Worm BaseAllele Name tm2134
CGC Name helq-1
Sequence Y55B1AL.3
Phenotypehomozygous viable
Mutation site10827/10828-11173/11174 (346 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(3949..4119, 4167..4328, 5429..5695, 5755..5990, 6621..7095, 9995..10169, 10219..10355, 10405..10497, 10596..10964, 11437..11615, 11672..12103, 13124..13199))
Map position-26.7
Balancer
Map position of balancer
Sequence of primersIntRev:TCTCCGTTACATCACCACCT,ExtRev:GATTACGAACGCCTCGAACA,IntFwd:TCAGCACAGCATCCATCCGT,ExtFwd:CCGAATGATGATAGGCCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McClendon TB, Sullivan MR, Bernstein KA, Yanowitz JL.
Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans.
Genetics 2016 203(1) 133-45 
[ PubMed ID = 26936927 ] [ RRC reference ]

Taylor MRG, Špírek M, Chaurasiya KR, Ward JD, Carzaniga R, Yu X, Egelman EH, Collinson LM, Rueda D, Krejci L, Boulton SJ.
Rad51 Paralogs Remodel Pre-synaptic Rad51 Filaments to Stimulate Homologous Recombination.
Cell 2015 162(2) 271-286 
[ PubMed ID = 26186187 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol. Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]

Kessler Z, Yanowitz J.
Methodological considerations for mutagen exposure in C. elegans.
Methods 2014 68(3) 441-9 
[ PubMed ID = 24768858 ] [ RRC reference ]

Muzzini DM, Plevani P, Boulton SJ, Cassata G, Marini F.
Caenorhabditis elegans POLQ-1 and HEL-308 function in two distinct DNA interstrand cross-link repair pathways.
DNA Repair (Amst.) 2008 7(6) 941-50 
[ PubMed ID = 18472307 ] [ RRC reference ]