Mutants (Isolated)

tm2126

Allele Nametm2126
Sequence NameC26E6.2
CGC Nameflh-2
Worm BaseAllele Name tm2126
CGC Name flh-2
Sequence C26E6.2
Phenotypehomozygous viable. Dr. V. Ambros: Genes & Dev. 22, 2520 (2008).
Mutation site35626/35627-35974/35975 (348 bp deletion)
ChromosomeIII
Putative gene structurejoin(34520..34753, 34880..35341, 35796..36071, 36248..36475, 36560..36661, 36908..37018)
Map position-2.31
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGACCGCCTGTATGGTGGA,IntRev:TCTAACGCAGTGATTAGGGA,ExtRev:GCAACGTTTGCCAGTGAATC,IntFwd:GCCTGTATGGTGGACACCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ow MC, Martinez NJ, Olsen PH, Silverman HS, Barrasa MI, Conradt B, Walhout AJ, Ambros V.
The FLYWCH transcription factors FLH-1, FLH-2, and FLH-3 repress embryonic expression of microRNA genes in C. elegans.
Genes Dev. 2008 22(18) 2520-34 
[ PubMed ID = 18794349 ] [ RRC reference ]