Mutants (Isolated)

tm2125

Allele Nametm2125
Sequence NameF35C11.1
CGC Namenlp-5
Worm BaseAllele Name tm2125
CGC Name nlp-5
Sequence F35C11.1
Phenotypehomozygous viable. Dr. C. Bargmann: viable, fertile, less exploratory on food. Dr. J. Alcedo: normal fertility and lifespan. Dr. Y. Iino: normal chemotaxis to NaCl, normal salt chemotaxis learning.
Mutation site7180/7181-GAAATGTA-8110/8111 (930 bp deletion + 8 bp insertion)
ChromosomeII
Putative gene structurejoin(6725..6781, 6826..6883, 7214..7351, 7760..7878)
Map position0.75
Balancer
Map position of balancer
Sequence of primersExtRev:CCTTACTACTCACCGTTCCT,IntRev:GCATCATGCCTACCTCGTGT,ExtFwd:TCAGCCTCTTCCTTGTACTA,IntFwd:TATAACCCTGACCCACACAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takayama J, Faumont S, Kunitomo H, Lockery SR, Iino Y.
Single-cell transcriptional analysis of taste sensory neuron pair in Caenorhabditis elegans.
Nucleic Acids Res. 2010 38(1) 131-42 
[ PubMed ID = 19875417 ] [ RRC reference ]