Allele Name | tm2123 |
Sequence Name | Y80D3A.3 |
CGC Name | ceh-51 |
Worm Base | Allele Name |
tm2123
|
CGC Name |
ceh-51
|
Sequence |
Y80D3A.3
|
Phenotype | lethal or sterile. Dr. M. Maduro: Development 136, 2735 (2009). |
Mutation site | 18370/18371-TNCCGGTTCTAGTA-19980/19981 (1610 bp deletion + 14 bp insertion) |
Chromosome | V |
Putative gene structure | join(18453..18706, 19777..20227) |
Map position | 18.26 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:GATCTGCTCGGGCGAAAGTC,IntFwd:GCACTATATGCCTAGATTCG,IntRev:CCGTCGCTCGTCAACCTTTA,ExtFwd:AGGGAGCACTATATGCCTAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Owraghi M, Broitman-Maduro G, Luu T, Roberson H, Maduro MF. Roles of the Wnt effector POP-1/TCF in the C. elegans endomesoderm specification gene network. Dev Biol 2010 340(2) 209-21
[ PubMed ID = 19818340 ]
[ RRC reference ]
|
Harrell JR, Goldstein B. Internalization of multiple cells during C. elegans gastrulation depends on common cytoskeletal mechanisms but different cell polarity and cell fate regulators. Dev Biol 2011 350(1) 1-12
[ PubMed ID = 20875815 ]
[ RRC reference ]
|
Rasmussen JP, Feldman JL, Reddy SS, Priess JR. Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans. PLoS Genet 2013 9(9) e1003772
[ PubMed ID = 24039608 ]
[ RRC reference ]
|
Broitman-Maduro G, Owraghi M, Hung WW, Kuntz S, Sternberg PW, Maduro MF. The NK-2 class homeodomain factor CEH-51 and the T-box factor TBX-35 have overlapping function in C. elegans mesoderm development. Development 2009 136(16) 2735-46
[ PubMed ID = 19605496 ]
[ RRC reference ]
|
|