Mutants (Isolated)

tm2123

Allele Nametm2123
Sequence NameY80D3A.3
CGC Nameceh-51
Worm BaseAllele Name tm2123
CGC Name ceh-51
Sequence Y80D3A.3
Phenotypelethal or sterile. Dr. M. Maduro: Development 136, 2735 (2009).
Mutation site18370/18371-TNCCGGTTCTAGTA-19980/19981 (1610 bp deletion + 14 bp insertion)
ChromosomeV
Putative gene structurejoin(18453..18706, 19777..20227)
Map position18.26
Balancer
Map position of balancer
Sequence of primersExtRev:GATCTGCTCGGGCGAAAGTC,IntFwd:GCACTATATGCCTAGATTCG,IntRev:CCGTCGCTCGTCAACCTTTA,ExtFwd:AGGGAGCACTATATGCCTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Owraghi M, Broitman-Maduro G, Luu T, Roberson H, Maduro MF.
Roles of the Wnt effector POP-1/TCF in the C. elegans endomesoderm specification gene network.
Dev Biol 2010 340(2) 209-21 
[ PubMed ID = 19818340 ] [ RRC reference ]

Harrell JR, Goldstein B.
Internalization of multiple cells during C. elegans gastrulation depends on common cytoskeletal mechanisms but different cell polarity and cell fate regulators.
Dev Biol 2011 350(1) 1-12 
[ PubMed ID = 20875815 ] [ RRC reference ]

Rasmussen JP, Feldman JL, Reddy SS, Priess JR.
Cell interactions and patterned intercalations shape and link epithelial tubes in C. elegans.
PLoS Genet 2013 9(9) e1003772 
[ PubMed ID = 24039608 ] [ RRC reference ]

Broitman-Maduro G, Owraghi M, Hung WW, Kuntz S, Sternberg PW, Maduro MF.
The NK-2 class homeodomain factor CEH-51 and the T-box factor TBX-35 have overlapping function in C. elegans mesoderm development.
Development 2009 136(16) 2735-46 
[ PubMed ID = 19605496 ] [ RRC reference ]