Mutants (Isolated)

tm2118

Allele Nametm2118
Sequence NameY11D7A.12
CGC Nameflh-1
Worm BaseAllele Name tm2118
CGC Name flh-1
Sequence Y11D7A.12
Phenotypehomozygous viable. Dr. I. Mori: normal thermotaxis. Dr. V. Ambros: Genes & Dev. 22, 2520 (2008).
Mutation site35995/35996-36702/36703 (707 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(34286..34795, 34842..35612, 35661..35886, 36399..36415))
Map position4.12
Balancer
Map position of balancer
Sequence of primersExtFwd:AGCAATTGTGGCGGTCTGCA,IntFwd:GCGGTCTGCAATGGCTTAAA,ExtRev:GACAGTAGTCCACGCGCATA,IntRev:CACGCGCATAACTGTTCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ow MC, Martinez NJ, Olsen PH, Silverman HS, Barrasa MI, Conradt B, Walhout AJ, Ambros V.
The FLYWCH transcription factors FLH-1, FLH-2, and FLH-3 repress embryonic expression of microRNA genes in C. elegans.
Genes Dev. 2008 22(18) 2520-34 
[ PubMed ID = 18794349 ] [ RRC reference ]