Mutants (Isolated)

tm2111

Allele Nametm2111
Sequence NameY94H6A.4
CGC Namegpx-4
Worm BaseAllele Name tm2111
CGC Name gpx-4
Sequence Y94H6A.4
Phenotypehomozygous viable
Mutation site1052/1053-1585/1586 (533 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(1124..1287, 2132..2284, 2339..2402))
Map position-6.76
Balancer
Map position of balancer
Sequence of primersExtRev:TACACGCCGTGGTATCTTTG,IntRev:GGCATCGAATTCCCTACTTA,ExtFwd:CAGATGCTCGAATCGGGTTG,IntFwd:GGACTAAGCGGGGCTACCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]