Mutants (Isolated)

tm2109

Allele Nametm2109
Sequence NameY59A8B.12
CGC NameY59A8B.12
Worm BaseAllele Name tm2109
CGC Name Y59A8B.12
Sequence Y59A8B.12
Phenotypehomozygous viable
Mutation site156661/156662-157105/157106 (444 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(156260..156491, 156538..156662))
Map position13.93
Balancer
Map position of balancer
Sequence of primersExtFwd:TCTCGCCCATGAGAGACACA,IntRev:CCGGTGGTCTGAAAATCAAG,ExtRev:TCCCAGGTTCCGACTCACTT,IntFwd:GATATTGCGTACTTCGCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Calixto A, Chelur D, Topalidou I, Chen X, Chalfie M.
Enhanced neuronal RNAi in C. elegans using SID-1.
Nat. Methods 2010 7(7) 554-9 
[ PubMed ID = 20512143 ] [ RRC reference ]