Mutants (Isolated)

tm2104

Allele Nametm2104
Sequence NameY54G2A.35
CGC Nameser-6
Worm BaseAllele Name tm2104
CGC Name ser-6
Sequence Y54G2A.35
Phenotypehomozygous viable
Mutation site209906/209907-AGGCAACCGTACAGCA-210581/210582 (675 bp deletion + 16 bp insertion)
ChromosomeIV
Putative gene structurejoin(209902..210084, 210691..210854, 210912..211218, 212171..212388, 212516..212560, 213591..213879)
Map position-6.84
Balancer
Map position of balancer
Sequence of primersIntFwd:GTGCAGGCATGTAGGTATCT,ExtFwd:GGTAGGCGCCCTAAAGATTC,IntRev:TGACCGAGTTACGGCCTGTT,ExtRev:ATCCGACATCGATGGAGGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yoshida M, Oami E, Wang M, Ishiura S, Suo S.
Nonredundant function of two highly homologous octopamine receptors in food-deprivation-mediated signaling in Caenorhabditis elegans.
J. Neurosci. Res. 2014 92(5) 671-8 
[ PubMed ID = 24446241 ] [ RRC reference ]

Churgin MA, McCloskey RJ, Peters E, Fang-Yen C.
Antagonistic Serotonergic and Octopaminergic Neural Circuits Mediate Food-Dependent Locomotory Behavior in Caenorhabditis elegans.
J. Neurosci. 2017 37(33) 7811-7823 
[ PubMed ID = 28698386 ] [ RRC reference ]

Li Z, Li Y, Yi Y, Huang W, Yang S, Niu W, Zhang L, Xu Z, Qu A, Wu Z, Xu T.
Dissecting a central flip-flop circuit that integrates contradictory sensory cues in C. elegans feeding regulation.
Nat Commun 2012 3 776 
[ PubMed ID = 22491324 ] [ RRC reference ]

Vidal-Gadea A, Topper S, Young L, Crisp A, Kressin L, Elbel E, Maples T, Brauner M, Erbguth K, Axelrod A, Gottschalk A, Siegel D, Pierce-Shimomura JT.
Caenorhabditis elegans selects distinct crawling and swimming gaits via dopamine and serotonin.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(42) 17504-9 
[ PubMed ID = 21969584 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J. 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]