Home > Mutants (Isolated) > tm2095

Mutants (Isolated)

Allele Name		tm2095
Sequence Name		K09A9.2
CGC Name		rab-14
Worm Base	Allele Name	tm2095
	CGC Name	rab-14
	Sequence	K09A9.2
Phenotype		homozygous viable. Dr. O. Blacque: dye-filling normal. Dr. S. Eimer: normal levamisole receptor trafficking.
Mutation site		28564/28565-29266/29267 (702 bp deletion)
Chromosome		X
Putative gene structure		complement(join(27534..27696, 27760..27878, 28371..28615, 28762..28867))
Map position		22.93
Balancer
Map position of balancer
Sequence of primers		IntRev:ACGTGCGCATTCACTCGTCA,ExtRev:GGCTCAACACCAATGACAGA,IntFwd:GCTGCACGTGGCAAGTTCTG,ExtFwd:ATGGGTGACAAGCTCTCACA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Yin J, Huang Y, Guo P, Hu S, Yoshina S, Xuan N, Gan Q, Mitani S, Yang C, Wang X. GOP-1 promotes apoptotic cell degradation by activating the small GTPase Rab2 in C. elegans. J Cell Biol 2017 216(6) 1775-1794  [ PubMed ID = 28424218 ] [ RRC reference ] Guo P, Hu T, Zhang J, Jiang S, Wang X. Sequential action of Caenorhabditis elegans Rab GTPases regulates phagolysosome formation during apoptotic cell degradation. Proc Natl Acad Sci U S A 2010 107(42) 18016-21  [ PubMed ID = 20921409 ] [ RRC reference ] Sasidharan N, Sumakovic M, Hannemann M, Hegermann J, Liewald JF, Olendrowitz C, Koenig S, Grant BD, Rizzoli SO, Gottschalk A, Eimer S. RAB-5 and RAB-10 cooperate to regulate neuropeptide release in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2012 109(46) 18944-9  [ PubMed ID = 23100538 ] [ RRC reference ] Huang J, Wang H, Chen Y, Wang X, Zhang H. Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance. Development 2012 139(24) 4613-22  [ PubMed ID = 23172915 ] [ RRC reference ]