Mutants (Isolated)

tm2079

Allele Nametm2079
Sequence NameF53B7.5
CGC Namefig-1
Worm BaseAllele Name tm2079
CGC Name fig-1
Sequence F53B7.5
Phenotypehomozygous viable
Mutation site755/756-1872/1873 (1117 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(Z72507.1:36224..36344, Z72507.1:36517..36668, 39..602, 672..868, 916..1105, 1149..2740, 2832..3318, 3371..3507, 3561..4107, 4160..4725, 4770..5060, 5139..5528, 5574..5915, 5960..6701, 6754..7092, 7153..7289, 7332..8823))
Map position2.88
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGTTGCTGCGGGAGCTAGT,IntFwd:TCCATCTGGAGTGACCCATT,ExtRev:ATGCTATGGAGGATCAGCAA,IntRev:AGTTCGAGTGGGCAATGGAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication