Home > Mutants (Isolated) > tm2078

Mutants (Isolated)

Allele Name		tm2078
Allele Type		Normal
Sequence Name		F11F1.7
Gene Name		ttr-52
Worm Base	Allele Name	tm2078
	Gene Name	ttr-52
	Sequence	F11F1.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		8240/8241-8971/8972 (731 bp deletion)
Chromosome		III
Putative gene structure		join(8111..8375, 8445..8653)
Map position		21.21
Balancer
Map position of balancer
Sequence of primers		ExtRev:GGGAGCATTATGGATCTGCA,IntFwd:GATTTATCAGGTCGGCAGAT,ExtFwd:GGCTGGAACGGCTTGGATTC,IntRev:ACCTATAATGCTCCGGGTGT
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Wang Y, Arnold ML, Smart AJ, Wang G, Androwski RJ, Morera A, Nguyen KCQ, Schweinsberg PJ, Bai G, Cooper J, Hall DH, Driscoll M, Grant BD. Large vesicle extrusions from C. elegans neurons are consumed and stimulated by glial-like phagocytosis activity of the neighboring cell. Elife 2023 12   [ PubMed ID = 36861960 ] [ RRC reference ] Raiders S, Black EC, Bae A, MacFarlane S, Klein M, Shaham S, Singhvi A. Glia actively sculpt sensory neurons by controlled phagocytosis to tune animal behavior. Elife 2021 10   [ PubMed ID = 33759761 ] [ RRC reference ] Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J. Developmentally programmed germ cell remodelling by endodermal cell cannibalism. Nat Cell Biol 2016 18(12) 1302-1310  [ PubMed ID = 27842058 ] [ RRC reference ] Zhang Y, Wang H, Kage-Nakadai E, Mitani S, Wang X. C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment. Curr Biol 2012 22(14) 1276-84  [ PubMed ID = 22727700 ] [ RRC reference ] Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D. CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells. Curr Biol 2012 22(14) 1267-75  [ PubMed ID = 22727702 ] [ RRC reference ] Huang J, Wang H, Chen Y, Wang X, Zhang H. Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance. Development 2012 139(24) 4613-22  [ PubMed ID = 23172915 ] [ RRC reference ] Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D. Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization. Nat Commun 2013 4 2726  [ PubMed ID = 24225442 ] [ RRC reference ] Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA. EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway. Nature 2015 517(7533) 219-22  [ PubMed ID = 25567286 ] [ RRC reference ]