Mutants (Isolated)

tm2078

Allele Nametm2078
Sequence NameF11F1.7
CGC Namettr-52
Worm BaseAllele Name tm2078
CGC Name ttr-52
Sequence F11F1.7
Phenotypehomozygous viable
Mutation site8240/8241-8971/8972 (731 bp deletion)
ChromosomeIII
Putative gene structurejoin(8111..8375, 8445..8653)
Map position21.21
Balancer
Map position of balancer
Sequence of primersExtRev:GGGAGCATTATGGATCTGCA,IntFwd:GATTTATCAGGTCGGCAGAT,ExtFwd:GGCTGGAACGGCTTGGATTC,IntRev:ACCTATAATGCTCCGGGTGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J.
Developmentally programmed germ cell remodelling by endodermal cell cannibalism.
Nat Cell Biol 2016 18(12) 1302-1310 
[ PubMed ID = 27842058 ] [ RRC reference ]

Zhang Y, Wang H, Kage-Nakadai E, Mitani S, Wang X.
C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment.
Curr Biol 2012 22(14) 1276-84 
[ PubMed ID = 22727700 ] [ RRC reference ]

Huang J, Wang H, Chen Y, Wang X, Zhang H.
Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance.
Development 2012 139(24) 4613-22 
[ PubMed ID = 23172915 ] [ RRC reference ]

Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D.
Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization.
Nat Commun 2013 4 2726 
[ PubMed ID = 24225442 ] [ RRC reference ]

Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA.
EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway.
Nature 2015 517(7533) 219-22 
[ PubMed ID = 25567286 ] [ RRC reference ]

Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D.
CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells.
Curr Biol 2012 22(14) 1267-75 
[ PubMed ID = 22727702 ] [ RRC reference ]