Mutants (Isolated)

tm2078

Allele Name

tm2078

Sequence Name

F11F1.7

CGC Name

ttr-52

Worm Base

Allele Name

CGC Name

Sequence

Phenotype

homozygous viable

Mutation site

8240/8241-8971/8972 (731 bp deletion)

Chromosome

III

Putative gene structure

join(8111..8375, 8445..8653)

Map position

21.21

Balancer

Map position of balancer

Sequence of primers

ExtRev:GGGAGCATTATGGATCTGCA,IntFwd:GATTTATCAGGTCGGCAGAT,ExtFwd:GGCTGGAACGGCTTGGATTC,IntRev:ACCTATAATGCTCCGGGTGT

Distributed lab

Depositor

Dr. S. Mitani

References

Raiders S, Black EC, Bae A, MacFarlane S, Klein M, Shaham S, Singhvi A.
Glia actively sculpt sensory neurons by controlled phagocytosis to tune animal behavior.
Elife 2021 10
[ PubMed ID = 33759761 ] [ RRC reference ]

Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J.
Developmentally programmed germ cell remodelling by endodermal cell cannibalism.
Nat Cell Biol 2016 18(12) 1302-1310
[ PubMed ID = 27842058 ] [ RRC reference ]

Zhang Y, Wang H, Kage-Nakadai E, Mitani S, Wang X.
C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment.
Curr Biol 2012 22(14) 1276-84
[ PubMed ID = 22727700 ] [ RRC reference ]

Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D.
CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells.
Curr Biol 2012 22(14) 1267-75
[ PubMed ID = 22727702 ] [ RRC reference ]

Huang J, Wang H, Chen Y, Wang X, Zhang H.
Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance.
Development 2012 139(24) 4613-22
[ PubMed ID = 23172915 ] [ RRC reference ]

Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D.
Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization.
Nat Commun 2013 4 2726
[ PubMed ID = 24225442 ] [ RRC reference ]

Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA.
EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway.
Nature 2015 517(7533) 219-22
[ PubMed ID = 25567286 ] [ RRC reference ]