Mutants (Isolated)

tm2078

Allele Nametm2078
Sequence NameF11F1.7
CGC Namettr-52
Worm BaseAllele Name tm2078
CGC Name ttr-52
Sequence F11F1.7
Phenotypehomozygous viable
Mutation site8240/8241-8971/8972 (731 bp deletion)
ChromosomeIII
Putative gene structurejoin(8111..8375, 8445..8653)
Map position21.21
Balancer
Map position of balancer
Sequence of primersExtRev:GGGAGCATTATGGATCTGCA,IntFwd:GATTTATCAGGTCGGCAGAT,ExtFwd:GGCTGGAACGGCTTGGATTC,IntRev:ACCTATAATGCTCCGGGTGT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zhang Y, Wang H, Kage-Nakadai E, Mitani S, Wang X.
C. elegans secreted lipid-binding protein NRF-5 mediates PS appearance on phagocytes for cell corpse engulfment.
Curr. Biol. 2012 22(14) 1276-84 
[ PubMed ID = 22727700 ] [ RRC reference ]

Neumann B, Coakley S, Giordano-Santini R, Linton C, Lee ES, Nakagawa A, Xue D, Hilliard MA.
EFF-1-mediated regenerative axonal fusion requires components of the apoptotic pathway.
Nature 2015 517(7533) 219-22 
[ PubMed ID = 25567286 ] [ RRC reference ]

Chen YZ, Mapes J, Lee ES, Skeen-Gaar RR, Xue D.
Caspase-mediated activation of Caenorhabditis elegans CED-8 promotes apoptosis and phosphatidylserine externalization.
Nat Commun 2013 4 2726 
[ PubMed ID = 24225442 ] [ RRC reference ]

Huang J, Wang H, Chen Y, Wang X, Zhang H.
Residual body removal during spermatogenesis in C. elegans requires genes that mediate cell corpse clearance.
Development 2012 139(24) 4613-22 
[ PubMed ID = 23172915 ] [ RRC reference ]

Abdu Y, Maniscalco C, Heddleston JM, Chew TL, Nance J.
Developmentally programmed germ cell remodelling by endodermal cell cannibalism.
Nat. Cell Biol. 2016 18(12) 1302-1310 
[ PubMed ID = 27842058 ] [ RRC reference ]

Mapes J, Chen YZ, Kim A, Mitani S, Kang BH, Xue D.
CED-1, CED-7, and TTR-52 regulate surface phosphatidylserine expression on apoptotic and phagocytic cells.
Curr. Biol. 2012 22(14) 1267-75 
[ PubMed ID = 22727702 ] [ RRC reference ]