Mutants (Isolated)

tm2073

Allele Nametm2073
Sequence NameF10G8.7
CGC Nameercc-1
Worm BaseAllele Name tm2073
CGC Name ercc-1
Sequence F10G8.7
Phenotypehomozygous viable
Mutation site23987/23988-24789/24790 (802 bp deletion)
ChromosomeI
Putative gene structurejoin(11802..11856, 23527..23756, 24439..24510, 24587..24688, 25639..25703, 27191..27310, 27642..27786)
Map position4.58
Balancer
Map position of balancer
Sequence of primersExtRev:CCCTGGCGTAGACCTAAATA,IntRev:CGGTAGGAATTACTCTGTTC,ExtFwd:CCTTCGTGAATCAGTGAGCT,IntFwd:TACCGTATTTTTGAGCGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M.
Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis.
Nat Commun 2015 6 7394 
[ PubMed ID = 26077599 ] [ RRC reference ]

Lans H, Marteijn JA, Schumacher B, Hoeijmakers JH, Jansen G, Vermeulen W.
Involvement of global genome repair, transcription coupled repair, and chromatin remodeling in UV DNA damage response changes during development.
PLoS Genet. 2010 6(5) e1000941 
[ PubMed ID = 20463888 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ. 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Pontier DB, Tijsterman M.
A robust network of double-strand break repair pathways governs genome integrity during C. elegans development.
Curr. Biol. 2009 19(16) 1384-8 
[ PubMed ID = 19646877 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res. 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J. Neurosci. 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]