Mutants (Isolated)

tm2064

Allele Nametm2064
Sequence NameB0496.5
CGC NameB0496.5
Worm BaseAllele Name tm2064
CGC Name B0496.5
Sequence B0496.5
Phenotypehomozygous viable. Dr. P. Sengupta: may have some thermotaxis phenotype.
Mutation site4959/4960-5339/5340 (380 bp deletion)
ChromosomeIV
Putative gene structurejoin(4767..4902, 4951..5027, 5076..5309, 5361..5573, 5615..5870, 5917..6068)
Map position3.37
Balancer
Map position of balancer
Sequence of primersExtFwd:GAGATCCAAATCCGGCGATA,IntRev:TTATCCCTTCCGTCAACGCA,IntFwd:GGTACTTCAACTGAAGGCTT,ExtRev:CCGTGTGCTCTGCTCTTTAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Biron D, Wasserman S, Thomas JH, Samuel AD, Sengupta P.
An olfactory neuron responds stochastically to temperature and modulates Caenorhabditis elegans thermotactic behavior.
Proc. Natl. Acad. Sci. U.S.A. 2008 105(31) 11002-7 
[ PubMed ID = 18667708 ] [ RRC reference ]