Mutants (Isolated)

tm2063

Allele Nametm2063
Sequence NameF53G12.1
CGC Namerab-11.1
Worm BaseAllele Name tm2063
CGC Name rab-11.1
Sequence F53G12.1
Phenotypelethal or sterile. Dr. M. Sundaram: embryonic and larval lethal, complements let-124 (cs73).
Mutation site1370/1371-1653/1654 (283 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(1585..1766, 1812..2103, 2155..2276, 2325..2364))
Map position-19.84
BalancerhT2
Map position of balancer
Sequence of primersIntFwd:AGGGTTTCTCGGTATCGAGT,ExtFwd:GTTGCTTTCTTGGCGAGGGT,IntRev:TAGCGTCGCGTACCCTCAGA,ExtRev:CTGCGAAAGGGGTACGGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Soulavie F, Hall DH, Sundaram MV.
The AFF-1 exoplasmic fusogen is required for endocytic scission and seamless tube elongation.
Nat Commun 2018 9(1) 1741 
[ PubMed ID = 29717108 ] [ RRC reference ]