Home > Mutants (Isolated) > tm2061

Mutants (Isolated)

Allele Name		tm2061
Allele Type		Normal
Sequence Name		ZK418.4
Gene Name		lin-37
Worm Base	Allele Name	tm2061
	Gene Name	lin-37
	Sequence	ZK418.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2744/2745-GAGTATAG-3533/3534 (789 bp deletion + 8 bp insertion)
Chromosome		III
Putative gene structure		complement(join(1751..1868, 2059..2228, 2276..2555, 2993..3127, 3177..3301))
Map position		-0.79
Balancer
Map position of balancer
Sequence of primers		ExtRev:CATGGATGATCACCCGCACT,IntRev:GTCACCGATCCTTGCGATGT,ExtFwd:GACCAAGTGCTTGCTCGACA,IntFwd:TCGACTCTCCAGGCTGGTAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Lee J, Taylor CA, Barnes KM, Shen A, Stewart EV, Chen A, Xiang YK, Bao Z, Shen K. A Myt1 family transcription factor defines neuronal fate by repressing non-neuronal genes. Elife 2019 8   [ PubMed ID = 31386623 ] [ RRC reference ]