Mutants (Isolated)

tm2056

Allele Nametm2056
Sequence NameF09E10.8
CGC Nametoca-1
Worm BaseAllele Name tm2056
CGC Name toca-1
Sequence F09E10.8
Phenotypehomozygous viable. Dr. K. Oegema: wt dyf.
Mutation site25101/25102-25873/25874 (772 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(24644..24713, 24843..25000, 25737..26353, 27287..27597, 28200..28484, 29314..29429, 34938..34970))
Map position-17.93
Balancer
Map position of balancer
Sequence of primersExtRev:ATGTGATACGCAATAGCGCT,IntRev:AGCGCTCAACTGCGCTCAGT,ExtFwd:ATGGGTGGCGGCTCAGACTT,IntFwd:GAGCTGGGCACGAAACCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bone CR, Chang YT, Cain NE, Murphy SP, Starr DA.
Nuclei migrate through constricted spaces using microtubule motors and actin networks in C. elegans hypodermal cells.
Development 2016 143(22) 4193-4202 
[ PubMed ID = 27697906 ] [ RRC reference ]

Chang YT, Dranow D, Kuhn J, Meyerzon M, Ngo M, Ratner D, Warltier K, Starr DA.
toca-1 is in a novel pathway that functions in parallel with a SUN-KASH nuclear envelope bridge to move nuclei in Caenorhabditis elegans.
Genetics 2013 193(1) 187-200 
[ PubMed ID = 23150597 ] [ RRC reference ]

Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet. 2009 5(10) e1000675 
[ PubMed ID = 19798448 ] [ RRC reference ]

Bai Z, Grant BD.
A TOCA/CDC-42/PAR/WAVE functional module required for retrograde endocytic recycling.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(12) E1443-52 
[ PubMed ID = 25775511 ] [ RRC reference ]