Home > Mutants (Isolated) > tm2036

Mutants (Isolated)

Allele Name		tm2036
Allele Type		Balanced
Sequence Name		Y42H9AR.3
Gene Name		rabs-5
Worm Base	Allele Name	tm2036
	Gene Name	rabs-5
	Sequence	Y42H9AR.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. S. Mitani: EMBO Reports 8, 152 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		5906/5907-G-6990/6991 (1084 bp deletion + 1 bp insertion)
Chromosome		IV
Putative gene structure		complement(join(4104..4293, 4787..5209, 5260..5674, 5764..5925, 6299..6545, 6591..6788, 7165..7221))
Map position		3.6
Balancer		,nT1 [qIs51]
Map position of balancer
Sequence of primers		ExtRev:ATGACGGTCCTGCTCTATTG,IntRev:CTATTGCGATTGAGATGCTC,ExtFwd:ATGGGTGTCCCCGAGAGGAT,IntFwd:ACAGTGATGACGTCGTCTAG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25  [ PubMed ID = 23173093 ] [ RRC reference ] Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H. Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis. Proc Natl Acad Sci U S A 2014 111(11) E978-87  [ PubMed ID = 24591580 ] [ RRC reference ] Gengyo-Ando K, Kuroyanagi H, Kobayashi T, Murate M, Fujimoto K, Okabe S, Mitani S. The SM protein VPS-45 is required for RAB-5-dependent endocytic transport in Caenorhabditis elegans. EMBO Rep 2007 8(2) 152-7  [ PubMed ID = 17235359 ] [ RRC reference ]