Mutants (Isolated)

tm2036

Allele Nametm2036
Sequence NameY42H9AR.3
CGC Namerabs-5
Worm BaseAllele Name tm2036
CGC Name rabs-5
Sequence Y42H9AR.3
Phenotypelethal or sterile. Dr. S. Mitani: EMBO Reports 8, 152 (2007).
Mutation site5906/5907-G-6990/6991 (1084 bp deletion + 1 bp insertion)
ChromosomeIV
Putative gene structurecomplement(join(4104..4293, 4787..5209, 5260..5674, 5764..5925, 6299..6545, 6591..6788, 7165..7221))
Map position3.6
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:ATGACGGTCCTGCTCTATTG,IntRev:CTATTGCGATTGAGATGCTC,ExtFwd:ATGGGTGTCCCCGAGAGGAT,IntFwd:ACAGTGATGACGTCGTCTAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Gengyo-Ando K, Kuroyanagi H, Kobayashi T, Murate M, Fujimoto K, Okabe S, Mitani S.
The SM protein VPS-45 is required for RAB-5-dependent endocytic transport in Caenorhabditis elegans.
EMBO Rep. 2007 8(2) 152-7 
[ PubMed ID = 17235359 ] [ RRC reference ]

Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H.
Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(11) E978-87 
[ PubMed ID = 24591580 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]