Allele Name | tm2036 |
Allele Type | Balanced |
Sequence Name | Y42H9AR.3 |
Gene Name | rabs-5 |
Worm Base | Allele Name |
tm2036
|
Gene Name |
rabs-5
|
Sequence |
Y42H9AR.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| lethal or sterile. Dr. S. Mitani: EMBO Reports 8, 152 (2007). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 5906/5907-G-6990/6991 (1084 bp deletion + 1 bp insertion) |
Chromosome | IV |
Putative gene structure | complement(join(4104..4293, 4787..5209, 5260..5674, 5764..5925, 6299..6545, 6591..6788, 7165..7221)) |
Map position | 3.6 |
Balancer | ,nT1 [qIs51] |
Map position of balancer | |
Sequence of primers | ExtRev:ATGACGGTCCTGCTCTATTG,IntRev:CTATTGCGATTGAGATGCTC,ExtFwd:ATGGGTGTCCCCGAGAGGAT,IntFwd:ACAGTGATGACGTCGTCTAG |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
C. elegans Deletion Mutant Consortium. large-scale screening for targeted knockouts in the Caenorhabditis elegans genome. G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
Maekawa M, Terasaka S, Mochizuki Y, Kawai K, Ikeda Y, Araki N, Skolnik EY, Taguchi T, Arai H. Sequential breakdown of 3-phosphorylated phosphoinositides is essential for the completion of macropinocytosis. Proc Natl Acad Sci U S A 2014 111(11) E978-87
[ PubMed ID = 24591580 ]
[ RRC reference ]
|
Gengyo-Ando K, Kuroyanagi H, Kobayashi T, Murate M, Fujimoto K, Okabe S, Mitani S. The SM protein VPS-45 is required for RAB-5-dependent endocytic transport in Caenorhabditis elegans. EMBO Rep 2007 8(2) 152-7
[ PubMed ID = 17235359 ]
[ RRC reference ]
|
|