Mutants (Isolated)

tm2034

Allele Nametm2034
Sequence NameC53C9.3
CGC Namekvs-1
Worm BaseAllele Name tm2034
CGC Name kvs-1
Sequence C53C9.3
Phenotypehomozygous viable
Mutation site10591/10592-11925/11926 (1334 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(7041..7098, 7844..7943, 7996..8225, 8885..9067, 9116..9230, 9786..9840, 10389..10541, 10631..10673, 11052..11233, 12115..12336, 12539..12629, 23154..23194))
Map position-1.34
Balancer
Map position of balancer
Sequence of primersIntRev:GGTGGCGTGTATGTGAGTAT,ExtRev:ACGAGGTGAGCTACTAGATC,IntFwd:CGTGAGCGCATTGAACGGTC,ExtFwd:GCCGTCCCCTTCGCAGAATT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cotella D, Hernandez-Enriquez B, Wu X, Li R, Pan Z, Leveille J, Link CD, Oddo S, Sesti F.
Toxic role of K+ channel oxidation in mammalian brain.
J. Neurosci. 2012 32(12) 4133-44 
[ PubMed ID = 22442077 ] [ RRC reference ]

Cai SQ, Sesti F.
Oxidation of a potassium channel causes progressive sensory function loss during aging.
Nat. Neurosci. 2009 12(5) 611-7 
[ PubMed ID = 19330004 ] [ RRC reference ]