Mutants (Isolated)

tm2031

Allele Nametm2031
Sequence NameK02G10.6b
CGC Namehyl-2
Worm BaseAllele Name tm2031
CGC Name hyl-2
Sequence K02G10.6b
Phenotypehomozygous viable
Mutation site24518/24519-26120/26121 (1602 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(23841..23957, 24344..24611, 24658..24810, 24857..24994, 25646..25733, 25780..25861, 25911..26054))
Map position-6.9
Balancer
Map position of balancer
Sequence of primersIntRev:CACTGCTCTACTGATAACAC,IntFwd:CCGTTAACAGAAGCATGATG,ExtRev:AGGCAGAACTGCCGTCGTTC,ExtFwd:ATACGCATTGGTGACAGGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Menuz V, Howell KS, Gentina S, Epstein S, Riezman I, Fornallaz-Mulhauser M, Hengartner MO, Gomez M, Riezman H, Martinou JC.
Protection of C. elegans from anoxia by HYL-2 ceramide synthase.
Science 2009 324(5925) 381-4 
[ PubMed ID = 19372430 ] [ RRC reference ]

Chan JP, Brown J, Hark B, Nolan A, Servello D, Hrobuchak H, Staab TA.
Loss of Sphingosine Kinase Alters Life History Traits and Locomotor Function in Caenorhabditis elegans.
Front Genet 2017 8 132 
[ PubMed ID = 28983319 ] [ RRC reference ]

Mosbech MB, Kruse R, Harvald EB, Olsen AS, Gallego SF, Hannibal-Bach HK, Ejsing CS, Færgeman NJ.
Functional loss of two ceramide synthases elicits autophagy-dependent lifespan extension in C. elegans.
PLoS ONE 2013 8(7) e70087 
[ PubMed ID = 23894595 ] [ RRC reference ]

Garcia AM, Ladage ML, Dumesnil DR, Zaman K, Shulaev V, Azad RK, Padilla PA.
Glucose induces sensitivity to oxygen deprivation and modulates insulin/IGF-1 signaling and lipid biosynthesis in Caenorhabditis elegans.
Genetics 2015 200(1) 167-84 
[ PubMed ID = 25762526 ] [ RRC reference ]