Mutants (Isolated)

tm2017

Allele Nametm2017
Sequence NameF38B7.1
CGC Nameccch-1
Worm BaseAllele Name tm2017
CGC Name ccch-1
Sequence F38B7.1
Phenotypehomozygous viable
Mutation site12563/12564-13283/13284 (720 bp deletion)
ChromosomeV
Putative gene structurejoin(888..976, 1062..1131, 8987..9192, 9524..9627, 11863..12178, 12276..12562, 12666..12780, 12833..12912, 13000..13115)
Map position3.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CAGTGTTCCCACCCGTCATA,IntFwd:TCAACGATCACCCATGTGAG,ExtRev:ACGTCTCGAAAGCGCATAAG,IntRev:GTGTCAACTAGCGGCATAGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Li W, Bandyopadhyay J, Hwaang HS, Park BJ, Cho JH, Lee JI, Ahnn J, Lee SK.
Two thioredoxin reductases, trxr-1 and trxr-2, have differential physiological roles in Caenorhabditis elegans.
Mol. Cells 2012 34(2) 209-18 
[ PubMed ID = 22836943 ] [ RRC reference ]