Mutants (Isolated)

tm2010

Allele Nametm2010
Sequence NameF54E7.3
CGC Namepar-3
Worm BaseAllele Name tm2010
CGC Name par-3
Sequence F54E7.3
Phenotypelethal or sterile
Mutation site15737/15738-16145/16146 (408 bp deletion)
ChromosomeIII
Putative gene structurejoin(10689..10856, 11263..11352, 11406..11468, 15070..15177, 15256..15403, 15867..16850, 17048..18163, 18537..18683, 18788..19010, 19435..19696, 21037..21212, 21564..22218)
Map position-1.46
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:GGATACACGTACACCGACTC,IntFwd:GACTCGAGTGCGCGTCTGAT,ExtRev:TCCGTACGGTTTAACGGTAC,IntRev:CACGTCCGGTCACAGTGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li B, Kim H, Beers M, Kemphues K.
Different domains of C. elegans PAR-3 are required at different times in development.
Dev. Biol. 2010 344(2) 745-57 
[ PubMed ID = 20678977 ] [ RRC reference ]

Achilleos A, Wehman AM, Nance J.
PAR-3 mediates the initial clustering and apical localization of junction and polarity proteins during C. elegans intestinal epithelial cell polarization.
Development 2010 137(11) 1833-42 
[ PubMed ID = 20431121 ] [ RRC reference ]