Mutants (Isolated)

tm2007

Allele Nametm2007
Sequence NameF11F1.7
CGC Namettr-52
Worm BaseAllele Name tm2007
CGC Name ttr-52
Sequence F11F1.7
Phenotypehomozygous viable
Mutation site7334/7335-TTTT-7804/7805 (470 bp deletion + 4 bp insertion)
ChromosomeIII
Putative gene structurejoin(8111..8375, 8445..8653)
Map position21.21
Balancer
Map position of balancer
Sequence of primersExtRev:ACATGAGCCTGCCTGCCTTA,IntFwd:GGCAAGGATTGAGCCGAAAG,ExtFwd:GTGCACGTGAAGTTACGGAT,IntRev:ACTATCACGATGTGGGCAAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kim HS, Kitano Y, Mori M, Takano T, Harbaugh TE, Mizutani K, Yanagimoto H, Miwa S, Ihara S, Kubota Y, Shibata Y, Ikenishi K, Garriga G, Nishiwaki K.
The novel secreted factor MIG-18 acts with MIG-17/ADAMTS to control cell migration in Caenorhabditis elegans.
Genetics 2014 196(2) 471-9 
[ PubMed ID = 24318535 ] [ RRC reference ]

Shibata Y, Kawakado Y, Hori N, Tanaka K, Inoue R, Takano T, Kubota Y, Nishiwaki K.
Organ Length Control by an ADAMTS Extracellular Protease in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(5) 1449-57 
[ PubMed ID = 26994289 ] [ RRC reference ]