Mutants (Isolated)

tm1994

Allele Nametm1994
Sequence NameC03G6.18+C03G6.19
CGC Namesrp-5+srp-6
Worm BaseAllele Name tm1994
CGC Name srp-5+srp-6
Sequence C03G6.18+C03G6.19
Phenotypehomozygous viable
Mutation site42994/42995-43323/43324 (329 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(40234..40395, 40443..40598, 40649..40971, 41019..41118, 41274..41522)) + complement(join(42521..42685, 42733..42888, 42939..43261, 43327..43505, 43552..43830, 44258..44283))
Map position0.74
Balancer
Map position of balancer
Sequence of primersExtFwd:CAACGGCCATTAAAGCTCGA,IntFwd:AGCTCGATTCAACCCAAGTG,ExtRev:TGCGAAATCACCTGCCTGAT,IntRev:GAGTGCAGGTTGTGAGCGTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Luke CJ, Pak SC, Askew YS, Naviglia TL, Askew DJ, Nobar SM, Vetica AC, Long OS, Watkins SC, Stolz DB, Barstead RJ, Moulder GL, Brömme D, Silverman GA.
An intracellular serpin regulates necrosis by inhibiting the induction and sequelae of lysosomal injury.
Cell 2007 130(6) 1108-19 
[ PubMed ID = 17889653 ] [ RRC reference ]