Mutants (Isolated)

tm1991

Allele Nametm1991
Sequence NameC27B7.4
CGC Namerad-26
Worm BaseAllele Name tm1991
CGC Name rad-26
Sequence C27B7.4
Phenotypehomozygous viable. Dr. M. Bastiani: axon regeneration defect. Dr. S. Kennedy: some nuclear RNAi response.
Mutation site8189/8190-TT-8936/8937 (747 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurejoin(4580..4667, 4719..4794, 7147..7535, 7585..7743, 7793..8185, 8230..8463, 8790..9535, 9615..10154, 10233..11196, 11240..11389, 11436..11521)
Map position4
Balancer
Map position of balancer
Sequence of primersExtFwd:TCGGCGCAGAAGATCTCGAT,IntFwd:GTGTTGGAAGCCCAGCGACT,ExtRev:CATGCGGAGAATGCCATTAG,IntRev:AGCACGTGAGTTCGTTGTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Leight ER, Murphy JT, Fantz DA, Pepin D, Schneider DL, Ratliff TM, Mohammad DH, Herman MA, Kornfeld K.
Conversion of the LIN-1 ETS protein of Caenorhabditis elegans from a SUMOylated transcriptional repressor to a phosphorylated transcriptional activator.
Genetics 2015 199(3) 761-75 
[ PubMed ID = 25567989 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]