Mutants (Isolated)

tm1983

Allele Nametm1983
Sequence NameZC334.1
CGC Nameins-26
Worm BaseAllele Name tm1983
CGC Name ins-26
Sequence ZC334.1
Phenotypehomozygous viable. Dr. C. Kenyon: grossly normal morphology and fertility, does not form dauer at 25C. Dr. J. Hubbard: no dauer formation at 20 & 25 C. Dr. T. Katada: No abnormal proliferation in Z2/Z3 cells during L1 diapause. Dr. P. Roy: normal muscle arm development. Dr. K. Ashrafi: normal Nile Red staining. Dr. M. Driscoll: normal dauer formation. Dr. Q.L. Ch'ng: normal locomotion and egg-laying. Dr. P.W. Sternberg: normal locomotion.
Mutation site31783/31784-32376/32377 (593 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(31630..31718, 31887..32130))
Map position22.89
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGAGGTAGATCACGGCACT,ExtFwd:CGGGGATGCAGAGGTAGATC,IntRev:TAGCCCGAATCTTCCTACAC,ExtRev:GTGATAAGCCTGGCAGGCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gruner M, Grubbs J, McDonagh A, Valdes D, Winbush A, van der Linden AM.
Cell-Autonomous and Non-Cell-Autonomous Regulation of a Feeding State-Dependent Chemoreceptor Gene via MEF-2 and bHLH Transcription Factors.
PLoS Genet. 2016 12(8) e1006237 
[ PubMed ID = 27487365 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev. Biol. 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Burton NO, Furuta T, Webster AK, Kaplan RE, Baugh LR, Arur S, Horvitz HR.
Insulin-like signalling to the maternal germline controls progeny response to osmotic stress.
Nat. Cell Biol. 2017 19(3) 252-257 
[ PubMed ID = 28166192 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet. 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]

Hung WL, Hwang C, Gao S, Liao EH, Chitturi J, Wang Y, Li H, Stigloher C, Bessereau JL, Zhen M.
Attenuation of insulin signalling contributes to FSN-1-mediated regulation of synapse development.
EMBO J. 2013 32(12) 1745-60 
[ PubMed ID = 23665919 ] [ RRC reference ]