Mutants (Isolated)

tm1979

Allele Nametm1979
Sequence NameE03A3.6
CGC Nameunc-79
Worm BaseAllele Name tm1979
CGC Name unc-79
Sequence E03A3.6
Phenotypehomozygous viable
Mutation site37940/37941-38266/38267 (326 bp deletion)
ChromosomeIII
Putative gene structurejoin(24461..24485,27010..27127,28653..28813,28869..28996, 29044..29158, 29201..29373, 29641..30177, 30307..30885, 31033..31348, 31402..31484, 31656..32618, 32667..32865, 33710..33868, 35414..35479, 36398..36665, 36713..36780, 36826..37056, 37103..37406, 37584..37736, 37788..38178, 38259..38480, 38816..39125, 39181..39401, Z35637.1:207..245, Z35637.1:291..464, Z35637.1:903..1042, Z35637.1:1095..1230)
Map position-3.89
Balancer
Map position of balancer
Sequence of primersIntFwd:CATACCGTATACCTAGTCGT,ExtFwd:GGTTACGGTAGACTCCGTGA,IntRev:TAACCCGAATCAGGGCTCTA,ExtRev:CGGGAGCTTCTGTTTACAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pierce-Shimomura JT, Chen BL, Mun JJ, Ho R, Sarkis R, McIntire SL.
Genetic analysis of crawling and swimming locomotory patterns in C. elegans.
Proc. Natl. Acad. Sci. U.S.A. 2008 105(52) 20982-7 
[ PubMed ID = 19074276 ] [ RRC reference ]