Mutants (Isolated)

tm1977

Allele Nametm1977
Sequence NameF35G2.1
CGC NameF35G2.1
Worm BaseAllele Name tm1977
CGC Name F35G2.1
Sequence F35G2.1
Phenotypehomozygous viable
Mutation site18667/18668-AC-19167/19168 (500 bp deletion + 2 bp insertion)
ChromosomeIV
Putative gene structurejoin(15649..15822, 16207..16268, 16323..16482, 17637..17755, 17804..18386, 18827..18892, 18949..19512, 19557..19634)
Map position5.79
Balancer
Map position of balancer
Sequence of primersExtRev:TGTCCTCCAGAATGACACGT,IntFwd:ATGGGGGGACTGTTCGCACT,ExtFwd:GGCAATTGTGCTGCGCGTTT,IntRev:GTCACCATGCAACCGATTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Qi W, Gromoff EDV, Xu F, Zhao Q, Yang W, Pfeifer D, Maier W, Long L, Baumeister R.
The secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans.
Nat Commun 2021 12(1) 1262 
[ PubMed ID = 33627668 ] [ RRC reference ]