Home > Mutants (Isolated) > tm1968

Mutants (Isolated)

Allele Name		tm1968
Allele Type		Normal
Sequence Name		Y37E11AR.2
Gene Name		siah-1
Worm Base	Allele Name	tm1968
	Gene Name	siah-1
	Sequence	Y37E11AR.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. K. Matsumoto: no copper sensitivity. Dr. C. Rongo: Normal GLR-1::GFP localization. Dr. O. Blacque: dye-filling normal.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10015/10016-10639/10640 (624 bp deletion)
Chromosome		IV
Putative gene structure		join(8465..8651, 9447..9608, 9662..9895, 10152..10727, 11296..11350, 11496..11541)
Map position		-2.39
Balancer
Map position of balancer
Sequence of primers		IntRev:TCTCACCTCTGTGGAGTATC,ExtRev:TCATTTGGGTGGCGCCTGAA,ExtFwd:GCTGCGTAGTGAATGCGCTT,IntFwd:CTTGGAGCCCAGAACTAGCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Kinet MJ, Malin JA, Abraham MC, Blum ES, Silverman MR, Lu Y, Shaham S. HSF-1 activates the ubiquitin proteasome system to promote non-apoptotic developmental cell death in C. elegans. Elife 2016 5   [ PubMed ID = 26952214 ] [ RRC reference ] Malin JA, Kinet MJ, Abraham MC, Blum ES, Shaham S. Transcriptional control of non-apoptotic developmental cell death in C. elegans. Cell Death Differ 2016 23(12) 1985-1994  [ PubMed ID = 27472063 ] [ RRC reference ] De Arras L, Seng A, Lackford B, Keikhaee MR, Bowerman B, Freedman JH, Schwartz DA, Alper S. An evolutionarily conserved innate immunity protein interaction network. J Biol Chem 2013 288(3) 1967-78  [ PubMed ID = 23209288 ] [ RRC reference ]