Mutants (Isolated)

tm1963

Allele Nametm1963
Sequence NameY39G10AR.22
CGC NameY39G10AR.22
Worm BaseAllele Name tm1963
CGC Name Y39G10AR.22
Sequence Y39G10AR.22
Phenotypelethal or sterile. Dr. P. Sengupta: lethal.
Mutation site46571/46572-47979/47980 (1408 bp deletion)
ChromosomeI
Putative gene structurejoin(46261..46438, 47206..47663, 48193..48426)
Map position-9.24
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CCTCGATCATAAATCCGGCA,IntFwd:CCGCACTGATGCTCATCGAA,ExtRev:GACCATGTGAGCACAGTCGA,ExtFwd:TCATGACGTACGTCCGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kim K, Sato K, Shibuya M, Zeiger DM, Butcher RA, Ragains JR, Clardy J, Touhara K, Sengupta P.
Two chemoreceptors mediate developmental effects of dauer pheromone in C. elegans.
Science 2009 326(5955) 994-8 
[ PubMed ID = 19797623 ] [ RRC reference ]

Lorenowicz MJ, Macurkova M, Harterink M, Middelkoop TC, de Groot R, Betist MC, Korswagen HC.
Inhibition of late endosomal maturation restores Wnt secretion in Caenorhabditis elegans vps-29 retromer mutants.
Cell. Signal. 2014 26(1) 19-31 
[ PubMed ID = 24056045 ] [ RRC reference ]