Mutants (Isolated)

tm1961

Allele Nametm1961
Sequence NameC29A12.4
CGC Namenrx-1
Worm BaseAllele Name tm1961
CGC Name nrx-1
Sequence C29A12.4
Phenotypehomozygous viable. Dr. Y. Jin: normal behavior. Dr. J. Rand: normal thermotaxis.
Mutation site22874/22875-23302/23303 (428 bp deletion)
ChromosomeV
Putative gene structurejoin(18021..18139, 18191..18346, 18685..18748, 19113..19280, 19324..19423, 19870..19943, 20010..20124, 20253..20413, 20741..20899, 21514..21871, 21958..22554, 22600..22697, 22743..22862, 22913..23021, 23069..23279, 23332..23529, 23571..23926, 24108..24287, 24714..25149, 25242..25345, 28528..28649, 31064..31157, 35431..35490, 38642..38781, 38835..38972, 39083..39193, 39284..39418)
Map position2.83
Balancer
Map position of balancer
Sequence of primersIntRev:TCTAACCTCCCGTTGAGCAT,ExtRev:TGGCCAGATGTTCGATAAGT,IntFwd:ATCTGGCCGATCAAAGTTAC,ExtFwd:GCAGTATGCACCTGAACTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Philbrook A, Ramachandran S, Lambert CM, Oliver D, Florman J, Alkema MJ, Lemons M, Francis MM.
Neurexin directs partner-specific synaptic connectivity in C. elegans.
Elife 2018 7  
[ PubMed ID = 30039797 ] [ RRC reference ]

Rodríguez-Ramos Á, Gámez-Del-Estal MM, Porta-de-la-Riva M, Cerón J, Ruiz-Rubio M.
Impaired Dopamine-Dependent Locomotory Behavior of C. elegans Neuroligin Mutants Depends on the Catechol-O-Methyltransferase COMT-4.
Behav. Genet. 2017 47(6) 596-608 
[ PubMed ID = 28879499 ] [ RRC reference ]

Calahorro F, Ruiz-Rubio M.
Human alpha- and beta-NRXN1 isoforms rescue behavioral impairments of Caenorhabditis elegans neurexin-deficient mutants.
Genes Brain Behav. 2013 12(4) 453-64 
[ PubMed ID = 23638761 ] [ RRC reference ]

Calahorro F, Ruiz-Rubio M.
Caenorhabditis elegans as an experimental tool for the study of complex neurological diseases: Parkinson's disease, Alzheimer's disease and autism spectrum disorder.
Invert. Neurosci. 2011 11(2) 73-83 
[ PubMed ID = 22068627 ] [ RRC reference ]

Calahorro F, Alejandre E, Ruiz-Rubio M.
Osmotic avoidance in Caenorhabditis elegans: synaptic function of two genes, orthologues of human NRXN1 and NLGN1, as candidates for autism.
J Vis Exp 2009 (34)  
[ PubMed ID = 20010541 ] [ RRC reference ]

Chen H, Li H, Wang D.
Graphene Oxide Dysregulates Neuroligin/NLG-1-Mediated Molecular Signaling in Interneurons in Caenorhabditis elegans.
Sci Rep 2017 7 41655 
[ PubMed ID = 28128356 ] [ RRC reference ]