Mutants (Isolated)

tm1956

Allele Nametm1956
Sequence NameK06H7.4
CGC Namegrp-1
Worm BaseAllele Name tm1956
CGC Name grp-1
Sequence K06H7.4
Phenotypehomozygous viable. Dr. G. Garriga: extra AVM/PVM neurons. Dr. H. Sawa: no Psa phenotype. Dr. O. Blacque: dye-filling normal. Dr. Y. Jin: no movement phenotype, grows well. Dr. O. Hobert: ASE differentiation defective.
Mutation site6313/6314-T-7296/7297 (983 bp deletion + 1 bp insertion)
ChromosomeIII
Putative gene structurejoin(5381..5399, 5451..5548, 5866..6051, 6126..6470, 6533..6744, 7319..7448, 7498..7689)
Map position-0.38
Balancer
Map position of balancer
Sequence of primersIntFwd:GGACTATCGGAGACGGAGAA,ExtFwd:CGCGGTATTCAGGTTTGTAC,IntRev:GTCCATCCGATAGAGAGAAT,ExtRev:CGGTGCCATCATTCGTGATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O.
A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans.
PLoS Genet 2011 7(6) e1002109 
[ PubMed ID = 21698137 ] [ RRC reference ]

Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G.
Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans.
Genetics 2014 198(1) 229-47 
[ PubMed ID = 25053664 ] [ RRC reference ]

Tehrani N, Del Rosario J, Dominguez M, Kalb R, Mano I.
The insulin/IGF signaling regulators cytohesin/GRP-1 and PIP5K/PPK-1 modulate susceptibility to excitotoxicity in C. elegans.
PLoS One 2014 9(11) e113060 
[ PubMed ID = 25422944 ] [ RRC reference ]

Denning DP, Hatch V, Horvitz HR.
Programmed elimination of cells by caspase-independent cell extrusion in C. elegans.
Nature 2012 488(7410) 226-30 
[ PubMed ID = 22801495 ] [ RRC reference ]