Home > Mutants (Isolated) > tm1956

Mutants (Isolated)

Allele Name		tm1956
Sequence Name		K06H7.4
CGC Name		grp-1
Worm Base	Allele Name	tm1956
	CGC Name	grp-1
	Sequence	K06H7.4
Phenotype		homozygous viable. Dr. G. Garriga: extra AVM/PVM neurons. Dr. H. Sawa: no Psa phenotype. Dr. O. Blacque: dye-filling normal. Dr. Y. Jin: no movement phenotype, grows well. Dr. O. Hobert: ASE differentiation defective.
Mutation site		6313/6314-T-7296/7297 (983 bp deletion + 1 bp insertion)
Chromosome		III
Putative gene structure		join(5381..5399, 5451..5548, 5866..6051, 6126..6470, 6533..6744, 7319..7448, 7498..7689)
Map position		-0.38
Balancer
Map position of balancer
Sequence of primers		IntFwd:GGACTATCGGAGACGGAGAA,ExtFwd:CGCGGTATTCAGGTTTGTAC,IntRev:GTCCATCCGATAGAGAGAAT,ExtRev:CGGTGCCATCATTCGTGATA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Poole RJ, Bashllari E, Cochella L, Flowers EB, Hobert O. A Genome-Wide RNAi Screen for Factors Involved in Neuronal Specification in Caenorhabditis elegans. PLoS Genet 2011 7(6) e1002109  [ PubMed ID = 21698137 ] [ RRC reference ] Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G. Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans. Genetics 2014 198(1) 229-47  [ PubMed ID = 25053664 ] [ RRC reference ] Tehrani N, Del Rosario J, Dominguez M, Kalb R, Mano I. The insulin/IGF signaling regulators cytohesin/GRP-1 and PIP5K/PPK-1 modulate susceptibility to excitotoxicity in C. elegans. PLoS One 2014 9(11) e113060  [ PubMed ID = 25422944 ] [ RRC reference ] Denning DP, Hatch V, Horvitz HR. Programmed elimination of cells by caspase-independent cell extrusion in C. elegans. Nature 2012 488(7410) 226-30  [ PubMed ID = 22801495 ] [ RRC reference ]