Mutants (Isolated)

tm1951

Allele Nametm1951
Allele TypeBalanced
Sequence NameC27C12.6
Gene Namedmd-4
Worm BaseAllele Name tm1951
Gene Name dmd-4
Sequence C27C12.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 28940/28941-29578/29579 (638 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(27679..27786, 27855..28284, 29064..29177, 31855..31914, 31977..32047))
Map position21.46
Balancer,tmC24[tmIs1240 tm9719]
Map position of balancer
Sequence of primersExtFwd:ATCCCCGTCTAGGACAGCAA,ExtRev:GAGTGTCTGTTCAAACGCAT,IntFwd:ATGAGGGGATTTGCCACAAG,IntRev:TCCCCTTGGCGGTTTTCTGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bayer EA, Stecky RC, Neal L, Katsamba PS, Ahlsen G, Balaji V, Hoppe T, Shapiro L, Oren-Suissa M, Hobert O.
Ubiquitin-dependent regulation of a conserved DMRT protein controls sexually dimorphic synaptic connectivity and behavior.
Elife 2020 9  
[ PubMed ID = 33021200 ] [ RRC reference ]