Mutants (Isolated)

tm1949

Allele Name

tm1949

Allele Type

Normal

Sequence Name

C02F4.1

Gene Name

ced-5

Worm Base

Allele Name

tm1949

Gene Name

ced-5

Sequence

C02F4.1

Phenotype

homozygous viable. Dr. M. Hengartner: defective in engulfment of apoptotic cells.

Mutation site

[F01D4] 32818/32819-AAAT-[F01D4] 33528/33529 (710 bp deletion + 4 bp insertion)

Chromosome

Putative gene structure

join(32257..32302, 32346..32702, 32752..32945, 32993..33129, 33177..33394, 33623..34711, 35028..35106, 35155..35286, 35449..35734, 35831..35992, 36039..36355, 37181..37256, 37616..37772, 37820..[C02F4]488, 1143..1274, 1322..1534, 1579..1923, 1972..2711, 2766..3319)

Map position

4.61

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GTTTACGGGCAGCACGGAGA,IntFwd:CGTATCGACAAGTGACGGAT,ExtRev:TCCGAAGTCTCACGATCATG,IntRev:CACGCCATCTCAACACATTC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Nørgaard S, Deng S, Cao W, Pocock R.
Distinct CED-10/Rac1 domains confer context-specific functions in development.
PLoS Genet 2018 14(9) e1007670
[ PubMed ID = 30265669 ] [ RRC reference ]

Pinto SM, Almendinger J, Cabello J, Hengartner MO.
Loss of Acetylcholine Signaling Reduces Cell Clearance Deficiencies in Caenorhabditis elegans.
PLoS One 2016 11(2) e0149274
[ PubMed ID = 26872385 ] [ RRC reference ]

Huang H, Zhu Y, Eliot MN, Knopik VS, McGeary JE, Carskadon MA, Hart AC.
Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.
Sleep 2017 40(6)
[ PubMed ID = 28431118 ] [ RRC reference ]

Neukomm LJ, Frei AP, Cabello J, Kinchen JM, Zaidel-Bar R, Ma Z, Haney LB, Hardin J, Ravichandran KS, Moreno S, Hengartner MO.
Loss of the RhoGAP SRGP-1 promotes the clearance of dead and injured cells in Caenorhabditis elegans.
Nat Cell Biol 2011 13(1) 79-86
[ PubMed ID = 21170032 ] [ RRC reference ]

Stavoe AK, Colón-Ramos DA.
Netrin instructs synaptic vesicle clustering through Rac GTPase, MIG-10, and the actin cytoskeleton.
J Cell Biol 2012 197(1) 75-88
[ PubMed ID = 22451697 ] [ RRC reference ]

Neukomm LJ, Nicot AS, Kinchen JM, Almendinger J, Pinto SM, Zeng S, Doukoumetzidis K, Tronchère H, Payrastre B, Laporte JF, Hengartner MO.
The phosphoinositide phosphatase MTM-1 regulates apoptotic cell corpse clearance through CED-5-CED-12 in C. elegans.
Development 2011 138(10) 2003-14
[ PubMed ID = 21490059 ] [ RRC reference ]

Neukomm LJ, Zeng S, Frei AP, Huegli PA, Hengartner MO.
Small GTPase CDC-42 promotes apoptotic cell corpse clearance in response to PAT-2 and CED-1 in C. elegans.
Cell Death Differ 2014 21(6) 845-53
[ PubMed ID = 24632947 ] [ RRC reference ]