Mutants (Isolated)

tm1945

Allele Nametm1945
Sequence NameZK930.3
CGC Namevab-23
Worm BaseAllele Name tm1945
CGC Name vab-23
Sequence ZK930.3
Phenotypelethal or sterile
Mutation site21410/21411-TC-22016/22017 (606 bp deletion + 2 bp insertion)
ChromosomeII
Putative gene structurecomplement(join(20712..20991, 21081..21265, 21451..21621))
Map position4.14
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:TGACCATCTTCTCGCCTCAA,ExtRev:CACATCCGGTGTTTGTCATG,IntFwd:CCGGATATTTCTCATGCCGT,ExtFwd:CAAGGGTGAGGGGCAATCTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Pellegrino MW, Farooqui S, Fröhli E, Rehrauer H, Kaeser-Pebernard S, Müller F, Gasser RB, Hajnal A.
LIN-39 and the EGFR/RAS/MAPK pathway regulate C. elegans vulval morphogenesis via the VAB-23 zinc finger protein.
Development 2011 138(21) 4649-60 
[ PubMed ID = 21989912 ] [ RRC reference ]

Pellegrino MW, Gasser RB, Sprenger F, Stetak A, Hajnal A.
The conserved zinc finger protein VAB-23 is an essential regulator of epidermal morphogenesis in Caenorhabditis elegans.
Dev. Biol. 2009 336(1) 84-93 
[ PubMed ID = 19799893 ] [ RRC reference ]