Mutants (Isolated)

tm1941

Allele Nametm1941
Allele TypeNormal
Sequence NameZC8.1
Gene Namehsd-2
Worm BaseAllele Name tm1941
Gene Name hsd-2
Sequence ZC8.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: normal dauer pheromone response.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 33159/33160-33599/33600 (440 bp deletion)
ChromosomeX
Putative gene structurejoin(32638..32799, 32842..32937, 32981..33154, 33199..33339, 33388..33534, 33901..34176, 34221..34349)
Map position-6.2
Balancer
Map position of balancer
Sequence of primersIntFwd:CCACCCAGAATATCGGCATC,ExtFwd:GCCCCACTTCGCAACACATA,IntRev:ATCTGTCATGACACAGGGTT,ExtRev:TTCTGTAGTCGCTGTAGCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Demoinet E, Li S, Roy R.
AMPK blocks starvation-inducible transgenerational defects in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(13) E2689-E2698 
[ PubMed ID = 28289190 ] [ RRC reference ]