Mutants (Isolated)

tm1939

Allele Nametm1939
Sequence NameW09C5.2
CGC Nameunc-59
Worm BaseAllele Name tm1939
CGC Name unc-59
Sequence W09C5.2
Phenotypehomozygous viable. Dr. F.P. Finger: Unc particularly in backing, Egl.
Mutation site1185/1186-1514/1515 (329 bp deletion)
ChromosomeI
Putative gene structurejoin(1098..1257, 1321..1534, 3348..3947, 3997..4075, 4809..5135)
Map position21.62
Balancer
Map position of balancer
Sequence of primersIntFwd:CGAGTGGTTCTGCAATGATA,ExtRev:TACGGGTTCAGTTGCCACGT,ExtFwd:ATGTGTTCGTTCTGCGGCAT,IntRev:CGGGACAAGAGGCATGTGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]