Allele Name | tm1925 |
Sequence Name | F54E7.7 |
CGC Name | rcn-1 |
Worm Base | Allele Name |
tm1925
|
CGC Name |
rcn-1
|
Sequence |
F54E7.7
|
Phenotype | homozygous viable. Dr. J. Ahnn: normal locomotion. |
Mutation site | 29063/29064-AATCGACAC-29521/29522 (458 bp deletion + 9 bp insertion) |
Chromosome | III |
Putative gene structure | complement(join(28954..29083, 29754..30014, 30065..30177, 30226..30345)) |
Map position | -1.46 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CCCGCGGCAGAATAAGCTCT,IntFwd:CACATGGAGATGAAGGGCGT,ExtRev:ACCCACACTCATGCACCATG,IntRev:TCCCTTGATGGCCATGGCTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Li W, Choi TW, Ahnn J, Lee SK. Allele-Specific Phenotype Suggests a Possible Stimulatory Activity of RCAN-1 on Calcineurin in Caenorhabditis elegans. Mol Cells 2016 39(11) 827-833
[ PubMed ID = 27871170 ]
[ RRC reference ]
|
Li W, Bell HW, Ahnn J, Lee SK. Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans. J Mol Biol 2015 427(22) 3457-3468
[ PubMed ID = 26232604 ]
[ RRC reference ]
|
Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM. Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins. J Cell Sci 2012 125(Pt 11) 2592-603
[ PubMed ID = 22393243 ]
[ RRC reference ]
|
|