Mutants (Isolated)

tm1925

Allele Nametm1925
Sequence NameF54E7.7
CGC Namercn-1
Worm BaseAllele Name tm1925
CGC Name rcn-1
Sequence F54E7.7
Phenotypehomozygous viable. Dr. J. Ahnn: normal locomotion.
Mutation site29063/29064-AATCGACAC-29521/29522 (458 bp deletion + 9 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(28954..29083, 29754..30014, 30065..30177, 30226..30345))
Map position-1.46
Balancer
Map position of balancer
Sequence of primersExtFwd:CCCGCGGCAGAATAAGCTCT,IntFwd:CACATGGAGATGAAGGGCGT,ExtRev:ACCCACACTCATGCACCATG,IntRev:TCCCTTGATGGCCATGGCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li W, Choi TW, Ahnn J, Lee SK.
Allele-Specific Phenotype Suggests a Possible Stimulatory Activity of RCAN-1 on Calcineurin in Caenorhabditis elegans.
Mol. Cells 2016 39(11) 827-833 
[ PubMed ID = 27871170 ] [ RRC reference ]

Li W, Bell HW, Ahnn J, Lee SK.
Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans.
J. Mol. Biol. 2015 427(22) 3457-3468 
[ PubMed ID = 26232604 ] [ RRC reference ]

Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J. Cell. Sci. 2012 125(Pt 11) 2592-603 
[ PubMed ID = 22393243 ] [ RRC reference ]