| Allele Name | tm1925 |
| Sequence Name | F54E7.7 |
| CGC Name | rcn-1 |
| Worm Base | Allele Name |
tm1925
|
| CGC Name |
rcn-1
|
| Sequence |
F54E7.7
|
| Phenotype | homozygous viable. Dr. J. Ahnn: normal locomotion. |
| Mutation site | 29063/29064-AATCGACAC-29521/29522 (458 bp deletion + 9 bp insertion) |
| Chromosome | III |
| Putative gene structure | complement(join(28954..29083, 29754..30014, 30065..30177, 30226..30345)) |
| Map position | -1.46 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCCGCGGCAGAATAAGCTCT,IntFwd:CACATGGAGATGAAGGGCGT,ExtRev:ACCCACACTCATGCACCATG,IntRev:TCCCTTGATGGCCATGGCTA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Li W, Choi TW, Ahnn J, Lee SK.
Allele-Specific Phenotype Suggests a Possible Stimulatory Activity of RCAN-1 on Calcineurin in Caenorhabditis elegans.
Mol Cells 2016 39(11) 827-833
[ PubMed ID = 27871170 ]
[ RRC reference ]
|
Li W, Bell HW, Ahnn J, Lee SK.
Regulator of Calcineurin (RCAN-1) Regulates Thermotaxis Behavior in Caenorhabditis elegans.
J Mol Biol 2015 427(22) 3457-3468
[ PubMed ID = 26232604 ]
[ RRC reference ]
|
Warburton-Pitt SR, Jauregui AR, Li C, Wang J, Leroux MR, Barr MM.
Ciliogenesis in Caenorhabditis elegans requires genetic interactions between ciliary middle segment localized NPHP-2 (inversin) and transition zone-associated proteins.
J Cell Sci 2012 125(Pt 11) 2592-603
[ PubMed ID = 22393243 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.