Mutants (Isolated)

tm1920

Allele Nametm1920
Sequence NameM03C11.5
CGC Nameymel-1
Worm BaseAllele Name tm1920
CGC Name ymel-1
Sequence M03C11.5
Phenotypehomozygous viable. Dr. G. Hermann: wild-type birefringent gut granules.
Mutation site29625/29626-AAAAAACAAA-30384/30385 (759 bp deletion + 10 bp insertion)
ChromosomeIII
Putative gene structurejoin(26792..26864, 27727..27957, 28604..28914, 29828..30087, 30311..30415, 30469..31168, 31493..31648, 31804..31998)
Map position2.47
Balancer
Map position of balancer
Sequence of primersIntRev:GTGGTGCCAAATCCGACACT,ExtRev:GCTCTCCTGTAGTACACGAT,IntFwd:GGCGATCGACAAATTGGTTC,ExtFwd:GTGCGTGTAGGCGATCGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Haynes CM, Yang Y, Blais SP, Neubert TA, Ron D.
The matrix peptide exporter HAF-1 signals a mitochondrial UPR by activating the transcription factor ZC376.7 in C. elegans.
Mol. Cell 2010 37(4) 529-40 
[ PubMed ID = 20188671 ] [ RRC reference ]

van Ham TJ, Thijssen KL, Breitling R, Hofstra RM, Plasterk RH, Nollen EA.
C. elegans model identifies genetic modifiers of alpha-synuclein inclusion formation during aging.
PLoS Genet. 2008 4(3) e1000027 
[ PubMed ID = 18369446 ] [ RRC reference ]