Home > Mutants (Isolated) > tm1917

Mutants (Isolated)

Allele Name		tm1917
Sequence Name		C41D11.1
CGC Name		eri-6
Worm Base	Allele Name	tm1917
	CGC Name	eri-6
	Sequence	C41D11.1
Phenotype		homozygous viable. Dr. G. Ruvkun: no visbile phenotypes.
Mutation site		33298/33299-35149/35150 (1851 bp deletion)
Chromosome		I
Putative gene structure		join(34408..34592, 34661..34754, 34805..34917, 34967..35153, 35210..35348, 35399..35505, 35551..35688)
Map position		-1.28
Balancer
Map position of balancer
Sequence of primers		ExtRev:CCCAATAGGACGACGGTTTT,IntFwd:CCCGGTGGTCCTTGAATACA,IntRev:GTGTACCTTCTTGCGGTACG,ExtFwd:CGTGTCGGTGCCAACACAAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Zhuang JJ, Hunter CP. The Influence of Competition Among C. elegans Small RNA Pathways on Development. Genes (Basel) 2012 3(4)   [ PubMed ID = 23483754 ] [ RRC reference ] Rosains J, Mango SE. Genetic characterization of smg-8 mutants reveals no role in C. elegans nonsense mediated decay. PLoS ONE 2012 7(11) e49490  [ PubMed ID = 23166684 ] [ RRC reference ] Kumsta C, Hansen M. C. elegans rrf-1 mutations maintain RNAi efficiency in the soma in addition to the germline. PLoS ONE 2012 7(5) e35428  [ PubMed ID = 22574120 ] [ RRC reference ] Zhuang JJ, Hunter CP. Tissue specificity of Caenorhabditis elegans enhanced RNA interference mutants. Genetics 2011 188(1) 235-7  [ PubMed ID = 21385728 ] [ RRC reference ] Zhuang JJ, Banse SA, Hunter CP. The nuclear argonaute NRDE-3 contributes to transitive RNAi in Caenorhabditis elegans. Genetics 2013 194(1) 117-31  [ PubMed ID = 23457236 ] [ RRC reference ] Fischer SE, Butler MD, Pan Q, Ruvkun G. Trans-splicing in C. elegans generates the negative RNAi regulator ERI-6/7. Nature 2008 455(7212) 491-6  [ PubMed ID = 18784652 ] [ RRC reference ]